Twist Bioscience(TWST)

Search documents
Twist Bioscience(TWST) - 2022 Q3 - Earnings Call Presentation
2022-08-05 12:20
G A G A G A L C T A ATCGATTS ICGAIA TGAGATCI W Fiscal 2022 3Q Financial Results AGATCTAG CGAT GATCOSTAGGTACAO ATGAGA TCATGAGATCCAGGATTCATGCTGC Agenda Welcome Angela Bitting SVP, Corporate Affairs; Chief ESG Officer Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | TWIST BIOSCIENCE i- Legal Disclaimers This presentation contains forward-looking stat ...
Twist Bioscience (TWST) Presents at the AGBT Conference 2022 - Slideshow
2022-06-18 15:33
| --- | --- | --- | --- | --- | |---------------------------------------------------------------------------------------------------------|-------|-------|-------|-------| | | | | | | | | | | | | | | | | | | | LOREM IPSUM | | | | | | DOLOR SIT AMET CONSECTETUR Twist Advances in NGS Applications Emily Leproust, PhD CEO and Co-Founder | | | | | | | | | | | 1 Legal Disclaimers This presentation contains forward-looking statements. In particular, statements regarding Twist Bioscience Corporation's ("Twist," "we ...
Twist Bioscience(TWST) - 2022 Q2 - Earnings Call Presentation
2022-05-06 06:58
GAGAIICTA ATCGATTS ICGAIA TGAGATCI W BIOSCIENCE Fiscal 2022 2Q Financial Results AGATCTAG CGAT GATCC CTACACACATGAGA TCATGAGATCCGATTCATGCTGC Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | TWIST BIOSCIENCE i- Legal Disclaimers This presentation contains forward-looking statements. All statements ...
Twist Bioscience(TWST) - 2022 Q2 - Quarterly Report
2022-05-05 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the quarterly period ended March 31, 2022 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 ...
Twist Bioscience Corp (TWST) Investor Presentation - Slideshow
2022-03-07 18:26
GAGATCTA ATCGATT I C G A T LT W BIOSCIENCE Writing the Future FEBRUARY 2022 AGATCTAGCGAT G G A T C C T A C G T A C A TCATGAGATTCAGGATTCATGCTGC - Forward-Looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained herein are forwardlooking statements reflecting the current beliefs and expectations of management and include statements regarding, among other things, future financial performance, expectations and objectives of mana ...
Twist Bioscience(TWST) - 2022 Q1 - Earnings Call Presentation
2022-02-17 20:57
Fiscal 2022 1Q Financial Results AGATCTAGCGA TAGGTACAC T C A T G A G A T C A T G C T G A T G C T G Agenda Welcome Angela Bitting SVP, Corporate Affairs Quarterly Highlights Emily Leproust Chief Executive Officer Financial and Operational Performance Jim Thorburn Chief Financial Officer Pipeline & Milestones Emily Leproust Chief Executive Officer Q&A Session 2 | T W I S T B I O S C I E N C E Legal Disclaimers This presentation contains forward-looking statements. All statements other than statements of histo ...
Twist Bioscience(TWST) - 2022 Q1 - Quarterly Report
2022-02-08 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-Q (Mark One) ☒ QUARTERLY REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 Commission File Number: 001-38720 Twist Bioscience Corporation For the quarterly period ended December 31, 2021 (Exact Name of Registrant as Specified in its Charter) Delaware 46-2058888 (State or other jurisdiction of (I.R.S. Employer incorporation or organization) Identification No.) 681 Gateway Blvd, South ...
Twist Bioscience(TWST) - 2022 Q1 - Earnings Call Transcript
2022-02-04 19:45
Twist Bioscience Corporation (NASDAQ:TWST) Q1 2022 Earnings Conference Call February 4, 2022 8:00 AM ET Company Participants Angela Bitting – Senior Vice President-Corporate Affairs and Chief ESG Officer Emily Leproust – Chief Executive Officer and Co-Founder Jim Thorburn – Chief Financial Officer Conference Call Participants Catherine Schulte – Baird Casey Rene Woodring – J. P. Morgan Puneet Souda – SVB Leerink Luke Sergott – Barclays Matt Sykes – Goldman Sachs Vijay Kumar – Evercore ISI Matt Larew – Willi ...
Twist Bioscience(TWST) - 2021 Q4 - Annual Report
2021-11-22 16:00
Table of Contents UNITED STATES SECURITIES AND EXCHANGE COMMISSION Washington, D.C. 20549 FORM 10-K (Mark One) ☒ ANNUAL REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the fiscal year ended September 30, 2021 OR ☐ TRANSITION REPORT PURSUANT TO SECTION 13 OR 15(d) OF THE SECURITIES EXCHANGE ACT OF 1934 For the transition period from to Commission File Number: 001-38720 Twist Bioscience Corporation (Exact Name of Registrant as Specified in its Charter) Delaware 46-205888 (Sta ...
Twist Bioscience(TWST) - 2021 Q4 - Earnings Call Presentation
2021-11-22 14:20
l - W ● BIOSCIENCE . Fiscal 2021 4Q and Year-End Financial Results November 22, 2021 Agenda | --- | --- | --- | |----------------------------------------|-------|-------| | | | | | | | | | Welcome Angela Bitting | | | | SVP, Corporate Affairs | | | | Quarterly and Annual Highlights | | | | Emily Leproust | | | | Chief Executive Officer | | | | Financial and Operational Performance | | | | Jim Thorburn | | | | Chief Financial Officer | | | | Pipeline & Milestones | | | | Emily Leproust Chief Executive Office ...